Foro - Perl en Español

por **Alfumao** » 2013-03-04 09:03 @419

Hola a todos,

Necesito ayuda con la interpretación de unos resultados complejos.

Tengo encadenados los resultados de un programa y he de extraer solo dos datos de cada informe individual que se repite modularmente miles de veces (os pongo un ejemplo del formato):

Sintáxis: [ Descargar ] [ Ocultar ]

Using text Syntax Highlighting

########################################

# Program: predicter

# Rundate: Wed 27 Feb 2013 23:42:03

# Commandline: predicter

#    -sequence ../Genes/NM_001163474.txt

#    -minrepeat 5

#    -maxrepeat 100

#    -outfile NM_001163474.out

# Report_format: table

# Report_file: NM_001163474.out

########################################

#=======================================

#

# Sequence: NM_001146075.1     from: 1   to: 3585

# HitCount: 1

#

# Threshold: 20

# Minrepeat: 5

# Maxrepeat: 100

# Mismatch: No

# Uniform: No

#

#=======================================

  Start     End  Strand   Score   Size  Count Identity Consensus             

     22      87       +      20     22      3     81.8 gcggggctgagcgtgagtcact

#---------------------------------------

#---------------------------------------Coloreado en 0.000 segundos,  usando GeSHi 1.0.8.4

De cada uno de estos módulos he de extraer los valores de los campos "Sequence:" y "HitCount:".

He hecho analizadores otras veces antes (gracias a lo aprendido en este foro, todo hay que decirlo), pero en éste me he atascado en los bucles y no consigo pasar los valores de los campos que busco a un array (que luego imprimiré si se cumple una condición).

Aquí os pongo el código (que se explicará mejor por sí mismo).

Seguro que es una tontería muy básica, pero yo llevo un rato laaaaargo con ello y ya no sé que más probar...

Sintáxis: [ Descargar ] [ Ocultar ]

Using perl Syntax Highlighting

#!usr/bin/perl 
use strict;
use Getopt::Long;
use Spreadsheet::WriteExcel;
 
#usage: perl script.pl -i [infile] -h [cutoff value]
 
my ( $file, $cutoff );
GetOptions(
    'infile=s' => \$file,
    'hits=i'   => \$cutoff,
);
 
open( INFILE, "$file" ) or die("ERROR: $!\n");
chomp( my @data = <INFILE> );
 
#print "Enter your cut-off e-value\n";
#chomp(my $evalue = <STDIN>);
open SALIDA, ">Parsed_results.txt" or die("ERROR: $!\n");
 
# Create a new workbook and add a worksheet
my $tabla     = "$^T" . "Results_parsed";
my $workbook  = Spreadsheet::WriteExcel->new( "$tabla" . ".xls" );
my $worksheet = $workbook->add_worksheet();
my $fila      = 1;
my @header    = ( "Query Seq.", "hits", "evalue" );
&ex_print( $worksheet, @header );
 
my @TM = ();
 
for (@data) {
 
    if ( /^\#\sProgram/ .. /^\#\sUniform/ ) {
 
        my ( $sequence, $hitcount );
 
        if (/^\#\sSequence\:\s(\w+)/)
        {                              #->"sequence", la regex lo captura lo pasa al array, pero luego es reemplazado por $hitcount
 
            $sequence = $1;
            print "Sequence: $sequence\n";
            push @TM, $sequence;
 
            #print SALIDA "$sequence\t";
 
            if (/HitCount\:\s(\d+)/) { #->hitcount, la regex lo captura pero no lo pasa al array
 
                $hitcount = $1;
                print "Hitcount: $hitcount\n";
                push @TM, $hitcount;
 
                #print SALIDA "$hitcount\n";
                print "@TM\n";
                if ( $TM[1] >= $cutoff ) {
                    push @TM, $sequence;
                    push @TM, $hitcount;
 
                    #print SALIDA "$sequence\t$hitcount\n";
                    #print "$sequence\t$hitcount\n";
                    print SALIDA "@TM\n";    #####->No me escribe nada
                    &ex_print( $worksheet, @TM );
 
                }
            }
        }
        @TM = ();                      #reinicialización
    }
}
 
close INFILE;
close SALIDA;
 
####################Subroutines####################
 
sub ex_print {
 
    my ( $worksheet, @TM ) = @_;
 
    $worksheet->write_row( "A" . "$fila", \@TM );
    $fila++;
 
}
 
Coloreado en 0.004 segundos,  usando GeSHi 1.0.8.4

Muchas gracias por adelantado

#!usr/bin/perl 
use strict;
use Getopt::Long;
use Spreadsheet::WriteExcel;
 
#usage: perl script.pl -i [infile] -h [cutoff value]
 
my ( $file, $cutoff );
GetOptions(
    'infile=s' => \$file,
    'hits=i'   => \$cutoff,
);
 
open( INFILE, "$file" ) or die("ERROR: $!\n");
chomp( my @data = <INFILE> );
open SALIDA, ">Parsed_results.txt" or die("ERROR: $!\n");
 
# Create a new workbook and add a worksheet
my $tabla     = "$^T" . "Results_parsed";
my $workbook  = Spreadsheet::WriteExcel->new( "$tabla" . ".xls" );
my $worksheet = $workbook->add_worksheet();
my $fila      = 1;
my @header    = ( "Query Seq.", "etandem hits", "evalue" );
&ex_print( $worksheet, @header );
 
my @TM = ();
my $sequence;
my $hitcount;
 
for (@data) {
 
    if ( /^\#\sProgram/ .. /^\#\sUniform/ ) {
 
        if (/^\#\sSequence\:\s(\w+)/) {
            $sequence = $1;
            print "Sequence: $sequence\n";
 
        }
        if (/HitCount\:\s(\d+)/) {
            $hitcount = $1;
            print "Hitcount: $hitcount\n";
 
            if ( $hitcount >= $cutoff ) {
                push @TM, $sequence;
                push @TM, $hitcount;
                print "@TM\n";
                print SALIDA "@TM\n";
                &ex_print( $worksheet, @TM );
            }
        }
 
        @TM = ();                      #reinicializacion
    }
}
 
close INFILE;
close SALIDA;
 
####################Subroutines####################
 
sub ex_print {
 
    my ( $worksheet, @TM ) = @_;
 
    $worksheet->write_row( "A" . "$fila", \@TM );
    $fila++;
}
 
Coloreado en 0.002 segundos,  usando GeSHi 1.0.8.4

por **explorer** » 2013-03-04 14:40 @653

Un poco más abreviado:

Sintáxis: [ Descargar ] [ Ocultar ]

Using perl Syntax Highlighting

#!usr/bin/perl
use strict;
use warnings;
use autodie;
use feature 'say';
 
use Getopt::Long;
use Spreadsheet::WriteExcel;
 
# usage: perl script.pl -i [infile] -h [cutoff value]
 
my($file, $cutoff);
 
GetOptions(
    'infile=s' => \$file,
    'hits=i'   => \$cutoff,
);
 
# Create a new workbook and add a worksheet
my $tabla     = $^T . '_Results_parsed.xls';
my $workbook  = Spreadsheet::WriteExcel->new($tabla);
my $worksheet = $workbook->add_worksheet();
my $fila      = 1;
my @header    = ( 'Query Seq.', 'etandem hits', 'evalue' );
 
excel_print($worksheet, @header);
 
 
# Process
my($sequence, $hitcount);
 
open my $INFILE, $file;
open my $SALIDA, '>Parsed_results.txt';
 
while (<$INFILE>) {
 
    if (/^#\sSequence:\s(\w+)/) {
        $sequence = $1;
#       say "Sequence: $sequence";
    }
 
    if (/^#\sHitCount:\s(\d+)/) {
        $hitcount = $1;
#       say "Hitcount: $hitcount";
 
        if ( $hitcount >= $cutoff ) {
#           say         "$sequence $hitcount";
            say $SALIDA "$sequence $hitcount";
            
            excel_print($worksheet, $sequence, $hitcount);
        }
    }
}
 
close $INFILE;
close $SALIDA;
 
#################### Subroutines ####################
 
sub excel_print {
    my ($worksheet, @TM) = @_;
 
    $worksheet->write_row( "A$fila", \@TM );
 
    $fila++;
}
Coloreado en 0.002 segundos,  usando GeSHi 1.0.8.4

por **Alfumao** » 2013-03-05 06:30 @312

Gracias una vez más, explorer :wink:

Foro - Perl en Español

Interpretación de resultados múltiples

Interpretación de resultados múltiples

Publicidad

Re: Interpretación de resultados múltiples

Re: Interpretación de resultados múltiples

Re: Interpretación de resultados múltiples

¿Quién está conectado?