• Publicidad

Fecha actual 2018-01-20 13:41 @611

News News of Bioinformática

Site map of Bioinformática » Foro : Bioinformática

Perl aplicado a la bioinformática

Rearreglar columnas

Hola, quisiera saber cómo hacer un rearreglo de columnas a partir de un array.

Lo que tengo es algo así (es a partir de un archivo de asignaciones taxonómicas):

#name value1 value2 value3 valueN
name1 9 5 3 9
name2 4 7 2 17
name3 12 3 7 7
y lo que quiero es algo así:
#name value
value1_name1 9
value2_name1 5
value3_name1 3
valueN_name1 9
value1_name2 4
value2_name2 7
value3_name2 2
valueN_name2 ...
Read more : Rearreglar columnas | Vistas : 146 | Respuestas : 1


Extraer ciertas columnas de un archivo

Hola.

Tengo este script que cuando lo hice se me olvidó escribir el código que omitiera la primera línea con un comentario

#Constructed from biom file

y que la segunda línea que también tiene una almohadilla

#OTU ID name_column1 name_column2 name_columnx... name_columnN

sea usada como variable.

El script funciona solo si elimino el comentario manualmente del archivo de entrada y no he podido agregar una línea que elimine el primer comentario y use todo lo ...
Read more : Extraer ciertas columnas de un archivo | Vistas : 281 | Respuestas : 2


Agrupar resultados de dos archivos

Hola, estoy comprando los blast de 450 genes de 7 organismos diferentes y quiero agrupar todos los resultados en un único archivo. Tengo dos ficheros para cada organismo, uno con todos los identificadores de los genes que quiero estudiar y otro con los resultados del blast, pero el problema es que si el blast no me da resultado no me pone una línea en blanco y luego agrupar todos los resultados es un poco tedioso ...
Read more : Agrupar resultados de dos archivos | Vistas : 420 | Respuestas : 3


Odd number of elements in hash assignment

Buenos días.

Estoy intentando crear un módulo de perl que me recorra línea a línea un archivo Uniprot y que devuelva un hash multidimensional a partir del cual el programa principal me permita imprimir a la salida estándar los campos ID, DE, DT, OS y SQ de cada entrada del archivo uniprot.

Sé que hay alguna entrada a la que le falta alguno de los campos, y creo que esto es lo que está haciendo ...
Read more : Odd number of elements in hash assignment | Vistas : 262 | Respuestas : 3


Script que funcione como trimmer de secuencias de nts

Hola.

Tengo que realizar un script que me permita leer un archivo fasta usando biotools (proporcionado por el usuario en la consola al invocar el programa) y que elimine las N del extremo 5' las del 3', que recorte los dos extremos en un número de nucleótidos indicados por el usuario en la consola al invocar el programa y que me devuelva un archivo con las secuencias recortadas e imprima por pantalla la cabecera del ...
Read more : Script que funcione como trimmer de secuencias de nts | Vistas : 286 | Respuestas : 1


Archivo multifasta

Buenos días.

Partimos de un archivo de texto con cadenas de DNA en formato FASTA:

>Rosalind_6404
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>Rosalind_5959
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>Rosalind_0808
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT

Y queremos que nos devuelva el ID de la cadena con el porcentaje de CG más elevado, éste incluido.

La salida sería:
Rosalind_0808
60.919540

¿Alguien sabría cómo hacerlo?

Gracias.
Read more : Archivo multifasta | Vistas : 401 | Respuestas : 7


bioinfo: mean sequence length in FASTA

«Para calcular la longitud promedio de las secuencias de un fichero FASTA estábamos usando el siguiente comando de Perl en el terminal».

Artículo
Read more : bioinfo: mean sequence length in FASTA | Vistas : 291 | Respuestas : 0


bioinfo: rooting and laddering Newick trees

«Esta entrada es para compartir un script Perl para enraizar árboles, muchos árboles, de manera automática, y ordenar los nodos por distancia.

Rubén Sancho y yo estamos probando el software GRAMPA, que requiere una colección de árboles de genes precalculados en formato Newick, pero además los quiere enraizados y ordenados de manera ascendente. Como son más de mil árboles no lo queríamos hacer uno a uno con FigTree, por poner un ejemplo; queríamos automatizarlo y ...
Read more : bioinfo: rooting and laddering Newick trees | Vistas : 284 | Respuestas : 0


bioinfo: Leyendo FASTQ con CPAN

«Buenas. Hace un par de años describía en otra entrada cómo leer de manera eficiente ficheros FASTQ con ayuda de kseq.h Para ello definí una clase C++ que llamábamos desde Perl5 con Inline::CPP. La entrada de hoy es para contar que se puede hacer lo mismo instalando el módulo Bio::DB::HTS::Kseq desde CPAN, previa instalación en tu sistema de la librería htslib».

use strict;
use Bio::DB::HTS::Kseq;

my ($length,$header,$sequence,$quality);

my $kseq = Bio::DB::HTS::Kseq->new("sample18MB.fq.gz");
my $iter = ...
Read more : bioinfo: Leyendo FASTQ con CPAN | Vistas : 249 | Respuestas : 0


bioinfo: One-liner para calcular el N50 de un ensamblaje

«El estadístico N50 se usa a menudo para resumir a grosso modo un ensamblaje de secuencias, que generalmente es un fichero FASTA con una serie de contigs.

Modificando la definición de la Wikipedia, N50 es la longitud de contigs tal que usando contigs de igual o mayor tamaño recuperamos la mitad de las bases de ese ensamblaje».

Artículo
Read more : bioinfo: One-liner para calcular el N50 de un ensamblaje | Vistas : 268 | Respuestas : 0


 

Identificarte  •  Registrarse


Estadísticas

Mensajes totales 36039 • Temas totales 7201 • Usuarios totales 1866